25roev05 25roev05

11-02-2022
Biology

contestada

What is the mRNA transcript if the complementary DNA is TCTGAG?

Respuesta :

10818570 10818570

11-02-2022

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

Answer Link

Otras preguntas

What is the best estimate of the product 289 and 7?

An aluminum engine block has a volume of 4.77 L and a mass of 12.88 kg. what is the density of the aluminum in grams per cubic centimeter

How do you write 3+0.3+0.009 word form and in standard form and expanded form

What did the Compromise of 1850 propose?

What is the ratio of 15/18=5/h

egypt became a unified kingdom early in its history because?

On Sunday, a local hamburger shop sold a combined total of 540 hamburgers and cheeseburgers. The number of cheeseburgers sold was three times the number of hamb

A balloon holds 20.0 liters of helium at 10.0°C. If the temperature increases to 50.0°C, and the pressure does not change, what will be the new volume of the b

Please solve this problem. Thnaks(3x-4)²

A painter can finish painting a house in 8 hours. Her assistant takes 10 hours to finish the same job. How long would it take them to complete the job if they