mimi4961 mimi4961
  • 12-11-2019
  • Mathematics
contestada

i need help with this please​

i need help with this please class=

Respuesta :

roschum roschum
  • 12-11-2019
Y=90 degrees as it’s a right angle and if you where to add 60 and 90 it would be 150 degrees taken away from 180 as all triangles angles adds up to 180 degrees hope this helps
Answer Link

Otras preguntas

I need help now fast A) 1B) 2 C)3D)4​
How many Nal atoms are in 4.80 x 10-3 moles of Nal? O 7.97 x 10-27 0 2.89 x 10-3 O 2.89 x 1021 O 1.25 x 1026
Which cell structure is made of a bilayer of phospholipids and encloses all cells?
AaBbCc x AaBbCc (use for all 3 questions) 1. What is the probability that this individual will: AABBcc 2. What is the probability that this individual will: AaB
Two hexagons have an area ratio of 36:49. Find the ratio of their perimeters.​
Pleaseeee answer correctly !!!!!!!!!!!!!!!!!!! Will mark Brianliest !!!!!!!!!!!!!!!!!!!!
need mRNA AMINO ACIDS 1.AATACGGGGGCGTAACCACTA 2. GCTAGTACGTGCACATTAGAA
excerpt from messages from my father
Write a paragraph explaining why Columbus's legacy should not be celebrated. Must include a topic sentence, two supporting ideas, one piece of evidence for each
How much does the past determine the future?